bamtobed

bedtools bamtobed is a conversion utility that converts sequence alignments in BAM format into BED, BED12, and/or BEDPE records.

Usage and option summary

Usage:

bedtools bamtobed [OPTIONS] -i <BAM>

(or):

bamToBed [OPTIONS] -i <BAM>
Option Description
-seq Write sequence addtional to bed6
-bedpe Write BAM alignments in BEDPE format. Only one alignment from paired-end reads will be reported. Specifically, it each mate is aligned to the same chromosome, the BAM alignment reported will be the one where the BAM insert size is greater than zero. When the mate alignments are interchromosomal, the lexicographically lower chromosome will be reported first. Lastly, when an end is unmapped, the chromosome and strand will be set to “.” and the start and end coordinates will be set to -1. By default, this is disabled and the output will be reported in BED format.
-bedpeseq Write sequence addtional to -bedpe
-mate1 When writing BEDPE (-bedpe) format, always report mate one as the first BEDPE “block”.
-bed12 Write “blocked” BED (a.k.a. BED12) format. This will convert “spliced” BAM alignments (denoted by the “N” CIGAR operation) to BED12. Forces -split.
-split Report each portion of a “split” BAM (i.e., having an “N” CIGAR operation) alignment as a distinct BED intervals.
-splitD Report each portion of a “split” BAM while obeying both “N” CIGAR and “D” operation. Forces -split.
-ed Use the “edit distance” tag (NM) for the BED score field. Default for BED is to use mapping quality. Default for BEDPE is to use the minimum of the two mapping qualities for the pair. When -ed is used with -bedpe, the total edit distance from the two mates is reported.
-tag Use other numeric BAM alignment tag for BED score. Default for BED is to use mapping quality. Disallowed with BEDPE output.
-color An R,G,B string for the color used with BED12 format. Default is (255,0,0).
-cigar Add the CIGAR string to the BED entry as a 7th column.

Default behavior

By default, each alignment in the BAM file is converted to a 6 column BED. The BED “name” field is comprised of the RNAME field in the BAM alignment. If mate information is available, the mate (e.g., “/1” or “/2”) field will be appended to the name.

$ bedtools bamtobed -i reads.bam | head -3
chr7   118970079   118970129   TUPAC_0001:3:1:0:1452#0/1   37   -
chr7   118965072   118965122   TUPAC_0001:3:1:0:1452#0/2   37   +
chr11  46769934    46769984    TUPAC_0001:3:1:0:1472#0/1   37   -

-seq Add sequence to bed

Add sequence to the default bed format.

$ bedtools bamtobed -seq -i reads.bam | head -2
chr20 62580871 62580972 ATAC/1 255 + CTGCAAGAGTCACCCCCGGGGCCACCCCTCCCAGCAGGTGGTGATGGATGGCCCGCAGCTGTGCACAGTGGGGCAGTCCTGCTTAGGTTCAGCAGCAGGTT
chr20 62581438 62581539 ATAC/2 255 - TTCTGCTGGGAGTGATGCCCATGCAGCGGACCGGTCACAAGCAGGCCAGGACGATCTGCCAGAAGCCCGCCTCACCGCAGGCCTGTGACGGCGTCAGGCTG

-tag Set the score field based on BAM tags

One can override the choice of the BAM MAPQ as the result BED record’s score field by using the -tag option. In the example below, we use the -tag option to select the BAM edit distance (the NM tag) as the score column in the resulting BED records.

$ bedtools bamtobed -i reads.bam -tag NM | head -3
chr7   118970079   118970129   TUPAC_0001:3:1:0:1452#0/1   1    -
chr7   118965072   118965122   TUPAC_0001:3:1:0:1452#0/2   3    +
chr11  46769934    46769984    TUPAC_0001:3:1:0:1472#0/1   1    -

-bedpe Set the score field based on BAM tags

The -bedpe option converts BAM alignments to BEDPE format, thus allowing the two ends of a paired-end alignment to be reported on a single text line. Specifically, it each mate is aligned to the same chromosome, the BAM alignment reported will be the one where the BAM insert size is greater than zero. When the mate alignments are interchromosomal, the lexicographically lower chromosome will be reported first. Lastly, when an end is unmapped, the chromosome and strand will be set to “.” and the start and end coordinates will be set to -1.

Note

When using this option, it is required that the BAM file is sorted/grouped by the read name. This allows bamToBed to extract correct alignment coordinates for each end based on their respective CIGAR strings. It also assumes that the alignments for a given pair come in groups of twos. There is not yet a standard method for reporting multiple alignments using BAM. bamToBed will fail if an aligner does not report alignments in pairs.

$ bedtools bamtobed -i reads.bam -bedpe | head -3
chr7   118965072   118965122   chr7   118970079   118970129 TUPAC_0001:3:1:0:1452#0 37     +     -
chr11  46765606    46765656    chr11  46769934    46769984 TUPAC_0001:3:1:0:1472#0 37     +     -
chr20  54704674    54704724    chr20  54708987    54709037 TUPAC_0001:3:1:1:1833#0 37     +

One can easily use samtools and bamToBed together as part of a UNIX pipe. In this example, we will only convert properly-paired (FLAG == 0x2) reads to BED format.

$ samtools view -bf 0x2 reads.bam | bedtools bamtobed -i stdin | head
chr7   118970079   118970129   TUPAC_0001:3:1:0:1452#0/1   37   -
chr7   118965072   118965122   TUPAC_0001:3:1:0:1452#0/2   37   +
chr11  46769934    46769984    TUPAC_0001:3:1:0:1472#0/1   37   -
chr11  46765606    46765656    TUPAC_0001:3:1:0:1472#0/2   37   +
chr20  54704674    54704724    TUPAC_0001:3:1:1:1833#0/1   37   +
chr20  54708987    54709037    TUPAC_0001:3:1:1:1833#0/2   37   -
chrX   9380413     9380463     TUPAC_0001:3:1:1:285#0/1    0    -
chrX   9375861     9375911     TUPAC_0001:3:1:1:285#0/2    0    +
chrX   131756978   131757028   TUPAC_0001:3:1:2:523#0/1    37   +
chrX   131761790   131761840   TUPAC_0001:3:1:2:523#0/2    37   -

-bedpeseq Add sequences for -bedpe

The -bedpeseq option converts BAM alignments to BEDPE format with two addtional columns as sequences for the first mate and second mate

Note

When using this option, it is required that the BAM file is sorted/grouped by the read name. This allows bamToBed to extract correct alignment coordinates for each end based on their respective CIGAR strings. It also assumes that the alignments for a given pair come in groups of twos. There is not yet a standard method for reporting multiple alignments using BAM. bamToBed will fail if an aligner does not report alignments in pairs.

$ bedtools bamtobed -i reads.bam -bedpeseq | head -1
chr20 62580871 62580972 chr20 62581438 62581539 ATAC 255 + - CTGCAAGAGTCACCCCCGGGGCCACCCCTCCCAGCAGGTGGTGATGGATGGCCCGCAGCTGTGCACAGTGGGGCAGTCCTGCTTAGGTTCAGCAGCAGGTT TTCTGCTGGGAGTGATGCCCATGCAGCGGACCGGTCACAAGCAGGCCAGGACGATCTGCCAGAAGCCCGCCTCACCGCAGGCCTGTGACGGCGTCAGGCTG

-split Creating BED12 features from “spliced” BAM entries.

bedtools bamtobed will, by default, create a BED6 feature that represents the entire span of a spliced/split BAM alignment. However, when using the -split command, a BED12 feature is reported where BED blocks will be created for each aligned portion of the sequencing read.

Chromosome  ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Exons       ***************                                    **********

BED/BAM A      ^^^^^^^^^^^^....................................^^^^

Result      ===============                                    ====
comments powered by Disqus